| Gene name |
SPBC23G7.16 |
| Gene ID |
09/H10 |
| Gene synonyms/obsolete |
ctr6 |
| Gene product |
copper transporter;
induced under copper limiting conditions; regulated by
Cuf1p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
789 |
| ORF length (spliced) |
447 |
| Entry clone length |
789 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
722T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC23G7.16.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATCACGGCGGTAATTC |
| Rev primer name |
SPBC23G7.16.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATGGCATAATCCTACAGTT |
| Amino acid length |
148 |
| Molecular weight |
16.7 |
| Isoelectric point (calc.) |
9.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
2 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSQFLLSLLAI |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |