| Gene name |
SPBC16E9.09c |
| Gene ID |
10/D10 |
| Gene synonyms/obsolete |
|
| Gene product |
COPII-coated vesicle
component; emp24 family; predicted N-terminal signal sequence;
involved in intracellular protein transport; involved in
secretory pathway |
| Entry clone |
Cloned |
| ORF length (unspliced) |
813 |
| ORF length (spliced) |
648 |
| Entry clone length |
813 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
606A:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC16E9.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGCTGGGAATTTTCGG |
| Rev primer name |
SPBC16E9.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACCAATTTCTCTTTGACG |
| Amino acid length |
215 |
| Molecular weight |
24.8 |
| Isoelectric point (calc.) |
8.8 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
2 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
ER; Golgi |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal,
DeltaVision |