Gene name |
SPAC17C9.02c |
Gene ID |
10/E11 |
Gene synonyms/obsolete |
lys7 |
Gene product |
alpha-aminoadipate
reductase-phosphopantetheinyl transferase; involved in lysine
biosynthesis (6th step); ACPS domain |
Entry clone |
Cloned (also cloned in
2004 trial) |
ORF length (unspliced) |
820 |
ORF length (spliced) |
777 |
Entry clone length |
820 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
420A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC17C9.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAACAAAAAGTATATAG |
Rev primer name |
SPAC17C9.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACAAGTCGTTCAATGTCTCC |
Amino acid length |
258 |
Molecular weight |
29.3 |
Isoelectric point (calc.) |
5.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal
|