| Gene name |
SPBC725.09c |
| Gene ID |
10/H09 |
| Gene synonyms/obsolete |
hob3 |
| Gene product |
amphiphysin; actin
cortical patch component; involved in cell cycle regulation;
Human BIN3 complements the F-actin localization defects caused
by loss of Hob3p; involved in cytokinesis; involved in actin
cytoskeletal organization; BAR domain; involved in
endocytosis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
837 |
| ORF length (spliced) |
795 |
| Entry clone length |
837 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
488T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC725.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTTGGCATGGATTCAA |
| Rev primer name |
SPBC725.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTGACTGTTGTTCAAACCG |
| Amino acid length |
264 |
| Molecular weight |
30 |
| Isoelectric point (calc.) |
6.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQSMRDLSI |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Confocal
|