Gene name |
SPAC688.02c |
Gene ID |
11/A09 |
Gene synonyms/obsolete |
|
Gene product |
spindle pole body
component; involved in chromosome segregation |
Entry clone |
Cloned |
ORF length (unspliced) |
848 |
ORF length (spliced) |
633 |
Entry clone length |
848 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC688.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGTCTCACGGAGATGC |
Rev primer name |
SPAC688.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGGAGTTTTTTCCAATCGG |
Amino acid length |
210 |
Molecular weight |
24.1 |
Isoelectric point (calc.) |
4.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol=nucleus;
SPB |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (SPB?) |
Microscope used for
observation |
Leica |