Gene name |
SPAC3G9.08 |
Gene ID |
11/B09 |
Gene synonyms/obsolete |
png1 |
Gene product |
zinc finger protein;
zf-PHD finger; involved in transcriptional regulation; histone
acetyltransferase complex; shares significant sequence
identity with the human candidate tumour suppressor p33 (ING1)
in their C-terminal regions; involved in chromatin mediated
transcriptional regulation; divergent orientation to hda1-may
share regulatory region |
Entry clone |
Cloned |
ORF length (unspliced) |
852 |
ORF length (spliced) |
|
Entry clone length |
852 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC3G9.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAGATGATACAGCTTA |
Rev primer name |
SPAC3G9.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTTAGCATCAACAAGCTTC |
Amino acid length |
283 |
Molecular weight |
31.2 |
Isoelectric point (calc.) |
5.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Leica |