| Gene name |
SPCC338.05c |
| Gene ID |
11/D03 |
| Gene synonyms/obsolete |
mms2; spm2 |
| Gene product |
ubiquitin conjugating
enzyme; involved in DNA repair; involved in error-free
post-replication repair; interacts physically with Spu13p;
functionally complements Sc MMS2; deletion mutant is sensitive
to DNA damaging agents |
| Entry clone |
Cloned |
| ORF length (unspliced) |
857 |
| ORF length (spliced) |
420 |
| Entry clone length |
857 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC338.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAAAAGTGTATGATTA |
| Rev primer name |
SPCC338.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAAAATGTACTACCCTCA |
| Amino acid length |
139 |
| Molecular weight |
15.5 |
| Isoelectric point (calc.) |
6.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |