Gene name |
SPCC320.11c |
Gene ID |
11/D07 |
Gene synonyms/obsolete |
SPCC330.18 |
Gene product |
involved in 60S
ribosomal subunit biogenesis |
Entry clone |
Cloned |
ORF length (unspliced) |
858 |
ORF length (spliced) |
543 |
Entry clone length |
858 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
219A:G / 689C:T |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC320.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGGCCTTTAACTCATGA |
Rev primer name |
SPCC320.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAAAAGAGTATCTTCATCA |
Amino acid length |
180 |
Molecular weight |
20.8 |
Isoelectric point (calc.) |
9.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleolus>nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |