| Gene name |
SPAC6G9.07c |
| Gene ID |
11/G09 |
| Gene synonyms/obsolete |
arp10 |
| Gene product |
ARP2/3
actin-organizing complex; involved in actin assembly and
function; involved in actin cortical patch assembly |
| Entry clone |
Cloned |
| ORF length (unspliced) |
873 |
| ORF length (spliced) |
507 |
| Entry clone length |
873 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
91T:C / 355A:G /
781A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC6G9.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTAAGAGAGGAATTCTT |
| Rev primer name |
SPAC6G9.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAACAACTCAGATAAGTT |
| Amino acid length |
168 |
| Molecular weight |
19.6 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |