Gene name |
SPAC3G9.10c |
Gene ID |
12/A06 |
Gene synonyms/obsolete |
|
Gene product |
exosome (RNase
complex); involved in rRNA processing; involved in mRNA
processing; involved in mRNA cleavage; possibly confers
antiviral activity by protecting cells from double-stranded
RNA (dsRNA) viruses; ribonuclease PH-like |
Entry clone |
Cloned |
ORF length (unspliced) |
888 |
ORF length (spliced) |
729 |
Entry clone length |
888 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC3G9.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTAAGAGATAGAATTTA |
Rev primer name |
SPAC3G9.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGCTGAGACTTGCAAGTGCC |
Amino acid length |
242 |
Molecular weight |
26.8 |
Isoelectric point (calc.) |
4.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB;
nucleus>cytosol; nuclear dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal,
DeltaVision |