Gene name |
SPAC30D11.13 |
Gene ID |
12/B08 |
Gene synonyms/obsolete |
hus5; ubc9 |
Gene product |
experimentally
characterised; ubiquitin conjugating enzyme; involved in
mitosis (required); interacts physically with Rad51p; SUMO
conjugator; involved in S phase arrest recovery
(required) |
Entry clone |
Cloned |
ORF length (unspliced) |
894 |
ORF length (spliced) |
474 |
Entry clone length |
894 |
No. of intron |
5 |
Sequence status |
Finished |
Sequence results |
242T:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC30D11.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCATCTCTTTGTAAAAC |
Rev primer name |
SPAC30D11.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGGAGCATTTTCACGAGCC |
Amino acid length |
157 |
Molecular weight |
17.9 |
Isoelectric point (calc.) |
9.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal |