| Gene name |
SPBC30D10.19c |
| Gene ID |
12/C05 |
| Gene synonyms/obsolete |
SPBC13E7.11 |
| Gene product |
rhomboid family
protease; involved in mitochondrial signal peptide processing;
similar to Sp SPBP4H10.10 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
897 |
| ORF length (spliced) |
|
| Entry clone length |
897 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
500T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC30D10.19.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATCGTTTGAATTTTCA |
| Rev primer name |
SPBC30D10.19.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAGGAAACGGATCTTGAA |
| Amino acid length |
298 |
| Molecular weight |
33.5 |
| Isoelectric point (calc.) |
11.1 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
8 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
mitochondrion? |
| Comments for localization |
vacuole
membrane? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |