| Gene name |
SPAC328.10c |
| Gene ID |
12/C11 |
| Gene synonyms/obsolete |
rps502; rps5-2 |
| Gene product |
experimentally
characterised; 40S ribosomal protein (S5) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
900 |
| ORF length (spliced) |
612 |
| Entry clone length |
900 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
The reverse primer is
identical to that of SPAC8C9.08. |
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC328.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAGCCTCTATCATCCC |
| Rev primer name |
SPAC328.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACGGTTACTCTTGGCAACA |
| Amino acid length |
203 |
| Molecular weight |
22.3 |
| Isoelectric point (calc.) |
10.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRRVNQALAL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleus>cytosol (intranuclear microtubule bundle?) |
| Microscope used for
observation |
Confocal |