Gene name |
SPAC328.10c |
Gene ID |
12/C11 |
Gene synonyms/obsolete |
rps502; rps5-2 |
Gene product |
experimentally
characterised; 40S ribosomal protein (S5) |
Entry clone |
Cloned |
ORF length (unspliced) |
900 |
ORF length (spliced) |
612 |
Entry clone length |
900 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
The reverse primer is
identical to that of SPAC8C9.08. |
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC328.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAGCCTCTATCATCCC |
Rev primer name |
SPAC328.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACGGTTACTCTTGGCAACA |
Amino acid length |
203 |
Molecular weight |
22.3 |
Isoelectric point (calc.) |
10.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRRVNQALAL |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
nucleus>cytosol (intranuclear microtubule bundle?) |
Microscope used for
observation |
Confocal |