Gene name |
SPCC970.06 |
Gene ID |
12/E12 |
Gene synonyms/obsolete |
|
Gene product |
cargo receptor for
soluble proteins; surfeit locus SURF40 family; 7 predicted
transmembrane helices |
Entry clone |
Cloned |
ORF length (unspliced) |
909 |
ORF length (spliced) |
|
Entry clone length |
909 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC970.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTTCACGTTCGCCGTT |
Rev primer name |
SPCC970.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATAAATCTTTTTCTTTTCA |
Amino acid length |
302 |
Molecular weight |
34.3 |
Isoelectric point (calc.) |
10.3 |
Signal SEQ |
|
No. of transmembrane domain |
7 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLLFVCVVLML/LLIFMFLGL/LSIVGGLLYL |
Localization (YFP) |
ER; Golgi |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal,
DeltaVision |