Chemical Genetics Laboratory
PREVIOUS  NEXT
Schizosaccharomyces pombe Postgenome Database

Gene name SPBC24C6.05
Gene ID 12/F03
Gene synonyms/obsolete sec28
Gene product coatomer (epsilon subunit); COPE family;TPR repeat protein; The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non- clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. Coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins; In mammals, the coatomer can only be recruited by membranes associated to ADP-ribosylation factors (ARFs), which are small GTP-binding proteins; the complex also influences the Golgi structural integrity, as well as the processing, activity, and endocytic recycling of LDL receptors (By similarity).
Entry clone Cloned
ORF length (unspliced) 911
ORF length (spliced) 867
Entry clone length 911
No. of intron 1
Sequence status Finished
Sequence results 19A:G
Comments
Polymerase used for cloning Platinum Taq HiFi (Invitrogen)
Fwd primer name SPBC24C6.05.Fd
Fwd primer SEQ AAAAAGCAGGCTCTCATATGTTTTCATGGGAGGCTAG
Rev primer name SPBC24C6.05.Rv
Rev primer SEQ AGAAAGCTGGGTAAGCCGTACTCAAAAATTGA
Amino acid length 288
Molecular weight 31.7
Isoelectric point (calc.) 4
Signal SEQ
No. of transmembrane domain
NLS position (Columbia Univ. Bioinformatics Center) none
NES motif ( L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) none
Localization (YFP) cytoplasmic dots; cytosol
Comments for localization nucleus by over expression
Effect of LMB on protein localization no change
Microscope used for observation DeltaVision

Image information
YFP 2 images) See all images

For plasmid request Click!
Copyright (c) RIKEN (The Institute of Physical and Chemical Research), Japan. All rights reserved.