Gene name |
SPBC24C6.05 |
Gene ID |
12/F03 |
Gene synonyms/obsolete |
sec28 |
Gene product |
coatomer (epsilon
subunit); COPE family;TPR repeat protein; The coatomer is a
cytosolic protein complex that binds to dilysine motifs and
reversibly associates with Golgi non- clathrin-coated
vesicles, which further mediate biosynthetic protein transport
from the ER, via the Golgi up to the trans Golgi network.
Coatomer complex is required for budding from Golgi membranes,
and is essential for the retrograde Golgi-to-ER transport of
dilysine-tagged proteins; In mammals, the coatomer can only be
recruited by membranes associated to ADP-ribosylation factors
(ARFs), which are small GTP-binding proteins; the complex also
influences the Golgi structural integrity, as well as the
processing, activity, and endocytic recycling of LDL receptors
(By similarity). |
Entry clone |
Cloned |
ORF length (unspliced) |
911 |
ORF length (spliced) |
867 |
Entry clone length |
911 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
19A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC24C6.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTTCATGGGAGGCTAG |
Rev primer name |
SPBC24C6.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCCGTACTCAAAAATTGA |
Amino acid length |
288 |
Molecular weight |
31.7 |
Isoelectric point (calc.) |
4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytoplasmic dots;
cytosol |
Comments for localization |
nucleus by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |