| Gene name |
SPAC13F5.04c |
| Gene ID |
12/H02 |
| Gene synonyms/obsolete |
|
| Gene product |
very hypothetical
protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
924 |
| ORF length (spliced) |
834 |
| Entry clone length |
924 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
25T:C / 222A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC13F5.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTGTTTTTTTTTTCGACT |
| Rev primer name |
SPAC13F5.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTCTGCAGTATGATTTCCC |
| Amino acid length |
277 |
| Molecular weight |
29.6 |
| Isoelectric point (calc.) |
8.2 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVSSFAILRI |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Confocal |