Gene name |
SPAC9.12c |
Gene ID |
12/H06 |
Gene synonyms/obsolete |
atp12 |
Gene product |
F1 ATPase chaperone;
ATP synthesis coupled proton transport; involved in
mitochondrial F1-F0 ATPase assembly |
Entry clone |
Cloned |
ORF length (unspliced) |
925 |
ORF length (spliced) |
864 |
Entry clone length |
925 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
131A:G / 185A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC9.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTTCGATCTTTACAATT |
Rev primer name |
SPAC9.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTGGGCATGTTCATTACTT |
Amino acid length |
287 |
Molecular weight |
33.1 |
Isoelectric point (calc.) |
7.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal |