Gene name |
SPAC31G5.13 |
Gene ID |
12/H09 |
Gene synonyms/obsolete |
rpn11; pad1; sks1;
bfr2 |
Gene product |
19S proteasome
regulatory subunit; MOV34 domain; essential; positive
regulator of pap1 dependent transcription; involved in the
maintenance of chromosome structure; overexpression confers
multidrug resistance; involved in deubiquitination |
Entry clone |
Cloned |
ORF length (unspliced) |
927 |
ORF length (spliced) |
|
Entry clone length |
927 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC31G5.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAATCTTTACAAAGATT |
Rev primer name |
SPAC31G5.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGAAGGCAACGGAATCAAGC |
Amino acid length |
308 |
Molecular weight |
34.5 |
Isoelectric point (calc.) |
6.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEEIMLLNL |
Localization (YFP) |
cytoplasmic dots;
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal |