| Gene name |
SPCC1020.12c |
| Gene ID |
13/A07 |
| Gene synonyms/obsolete |
SPCC14G10.06 |
| Gene product |
conserved
hypothetical; xap-5-like protein; human candidate disease gene
for Armfield syndrome ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
930 |
| ORF length (spliced) |
867 |
| Entry clone length |
930 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
557A:G / 614A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1020.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCGGCCATACTGATGC |
| Rev primer name |
SPCC1020.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGAGGGCCGGTAAAATAAT |
| Amino acid length |
288 |
| Molecular weight |
33.8 |
| Isoelectric point (calc.) |
9.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
50 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss |