Gene name |
SPCC191.12c |
Gene ID |
13/C04 |
Gene synonyms/obsolete |
SPCC1450.01c |
Gene product |
putative
pseudogene |
Entry clone |
Cloned |
ORF length (unspliced) |
944 |
ORF length (spliced) |
|
Entry clone length |
944 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
Cloned but is a
putative pseudogene. |
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC191.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAGCAGGAATCAAGTC |
Rev primer name |
SPCC191.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATCTAGTTAATGTCGTAACA |
Amino acid length |
|
Molecular weight |
|
Isoelectric point (calc.) |
|
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent signal
|
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
DeltaVision |