| Gene name |
SPBC23G7.07c |
| Gene ID |
13/D01 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved hypothetical
protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
949 |
| ORF length (spliced) |
834 |
| Entry clone length |
949 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
371T:deletion /
372T:deletion / 625T:C / 722T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC23G7.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCTACACGACAACAGA |
| Rev primer name |
SPBC23G7.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTAGAAACATATTTTGGTT |
| Amino acid length |
277 |
| Molecular weight |
31.6 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
56 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent signal
|
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |