| Gene name |
SPBC530.09c |
| Gene ID |
14/A01 |
| Gene synonyms/obsolete |
|
| Gene product |
cation dependent
mannose-6-phosphate receptor; involved in golgi-lysosomal
transport |
| Entry clone |
Cloned |
| ORF length (unspliced) |
975 |
| ORF length (spliced) |
891 |
| Entry clone length |
975 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC530.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGACTTCTCACATGCCT |
| Rev primer name |
SPBC530.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACGTATCAATATCATCAATA |
| Amino acid length |
296 |
| Molecular weight |
33.4 |
| Isoelectric point (calc.) |
5.3 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
2 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LINVLAGLTL |
| Localization (YFP) |
Golgi |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |