Gene name |
SPAC186.01 |
Gene ID |
14/B06 |
Gene synonyms/obsolete |
|
Gene product |
Sp specific families;
glycoprotein; serine/threonine-rich; similar to Sp SPBC359.04C
and SPBC947.04 |
Entry clone |
Cloned |
ORF length (unspliced) |
981 |
ORF length (spliced) |
|
Entry clone length |
981 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC186.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATGTGGTGAAGTACAT |
Rev primer name |
SPAC186.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATACAGTTGAAGTGTAACA |
Amino acid length |
326 |
Molecular weight |
35.2 |
Isoelectric point (calc.) |
4.1 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Leica |