Gene name |
SPBC1718.05 |
Gene ID |
14/B07 |
Gene synonyms/obsolete |
trs31 |
Gene product |
TRAPP plays a key role
in the late stages of endoplasmic reticulum to Golgi traffic;
Similarity Belongs to the TRAPP small subunits family; BET3
subfamily. |
Entry clone |
Cloned |
ORF length (unspliced) |
981 |
ORF length (spliced) |
630 |
Entry clone length |
981 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
83T:C / 518T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1718.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAATCCACTAATAAAGA |
Rev primer name |
SPBC1718.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATCCCAAAACTTCCTCTCTA |
Amino acid length |
209 |
Molecular weight |
23.8 |
Isoelectric point (calc.) |
8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>=cytosol;
nuclear envelope? |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |