Gene name |
SPBC13E7.09 |
Gene ID |
14/B09 |
Gene synonyms/obsolete |
|
Gene product |
verprolin;
proline-rich protein; involved in actin cytoskeletal
organization; actin cortical patch component; Wiskott-Aldrich
homolog; involved in endocytosis |
Entry clone |
Cloned |
ORF length (unspliced) |
982 |
ORF length (spliced) |
930 |
Entry clone length |
982 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
11C:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC13E7.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCACCTGCACCACCGCC |
Rev primer name |
SPBC13E7.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAATGAAGAGAGATTCAAA |
Amino acid length |
309 |
Molecular weight |
31.2 |
Isoelectric point (calc.) |
11.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |