Gene name |
SPCC16A11.10c |
Gene ID |
14/B11 |
Gene synonyms/obsolete |
oca8 |
Gene product |
cytochrome b5;
electron transporter; overexpression results in cell cycle
defects; similar to Sp SPBC29A10.16C |
Entry clone |
Cloned |
ORF length (unspliced) |
982 |
ORF length (spliced) |
390 |
Entry clone length |
982 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC16A11.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAGAGAAGACAATTAC |
Rev primer name |
SPCC16A11.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTGAGGACATACTTGCGA |
Amino acid length |
129 |
Molecular weight |
14.2 |
Isoelectric point (calc.) |
4.5 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |