| Gene name |
SPAC18B11.06 |
| Gene ID |
14/C02 |
| Gene synonyms/obsolete |
|
| Gene product |
U3 snoRNP component;
involved in rRNA processing |
| Entry clone |
Cloned |
| ORF length (unspliced) |
984 |
| ORF length (spliced) |
|
| Entry clone length |
984 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC18B11.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATGTATTAAATAAGAG |
| Rev primer name |
SPAC18B11.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACGACGTTTCAAATTCTTC |
| Amino acid length |
327 |
| Molecular weight |
37.6 |
| Isoelectric point (calc.) |
9.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
317 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVSLKCQLLL |
| Localization (YFP) |
one nuclear dot |
| Comments for localization |
nucleolus?; 1~2 dots
on nucleus |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |