Gene name |
SPAC664.01c |
Gene ID |
14/C10 |
Gene synonyms/obsolete |
swi6;
SPAC824.10c |
Gene product |
involved in
mating-type switching (required); silent heterochromatin
component; involved in chromosome segregation (required);
involved in chromosome cohesion (required); involved in
centromere function; involved in the association of Rad26p
with centromeres (required); deletion mutant results in
lagging chromosomes at mitosis at reduced temperature
(frequent); chromodomain protein; binds centromeric flanking
sequence; no apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
987 |
ORF length (spliced) |
|
Entry clone length |
987 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
851A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC664.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGAAAGGAGGTGTTCG |
Rev primer name |
SPAC664.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTCATTTTCACGGAACGTT |
Amino acid length |
328 |
Molecular weight |
37.2 |
Isoelectric point (calc.) |
4.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
150 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB; nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |