| Gene name |
SPAC18G6.15 |
| Gene ID |
14/C11 |
| Gene synonyms/obsolete |
mal3 |
| Gene product |
EB1 domain; calponin
homology domain; involved in microtubule cytoskeleton
organization and biogenesis; involved in spindle formation;
microtubule-associated protein; involved in cell shape and
size control; interacts physically with Moe1p; involved in
microtubule based movement; involved in microtubule loading
and/or processivity (required); functionally complemented by
human EB1 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
987 |
| ORF length (spliced) |
927 |
| Entry clone length |
987 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
18A:G / 222T:C /
979A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC18G6.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGAATCTCGGCAAGA |
| Rev primer name |
SPAC18G6.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAACGTGATATTCTCATCG |
| Amino acid length |
308 |
| Molecular weight |
35 |
| Isoelectric point (calc.) |
4.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
microtubules;
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |