Gene name |
SPAC6F6.10c |
Gene ID |
14/E05 |
Gene synonyms/obsolete |
|
Gene product |
ARP2/3
actin-organizing complex; involved in actin cortical patch
assembly; involved in actin assembly and function; involved in
endocytosis |
Entry clone |
Cloned |
ORF length (unspliced) |
994 |
ORF length (spliced) |
954 |
Entry clone length |
994 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC6F6.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTCTCATTAGATTATAA |
Rev primer name |
SPAC6F6.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCACGAACAAATGACCTA |
Amino acid length |
317 |
Molecular weight |
36.9 |
Isoelectric point (calc.) |
6.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytoplasmic dots at
cell tip and site of septum formation;
nucleus>=cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
nucleus>cytosol; cytoplasmic dots at cell tip and site of
septum formation |
Microscope used for
observation |
DeltaVision |