| Gene name |
SPCC306.06c |
| Gene ID |
14/F02 |
| Gene synonyms/obsolete |
|
| Gene product |
possibly involved in
cell wall maintenance; possibly involved in maintaining
beta,-1,6-glucan levels |
| Entry clone |
Cloned |
| ORF length (unspliced) |
998 |
| ORF length (spliced) |
936 |
| Entry clone length |
998 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
121T:C / 318A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC306.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTTCTTGGAGTATTTT |
| Rev primer name |
SPCC306.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAACTGTTTGCGTCGAGGA |
| Amino acid length |
311 |
| Molecular weight |
34.6 |
| Isoelectric point (calc.) |
4.6 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAVLVPTLFI |
| Localization (YFP) |
ER; vacuole
membrane? |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |