| Gene name |
SPAC17H9.05 |
| Gene ID |
14/F11 |
| Gene synonyms/obsolete |
|
| Gene product |
P40-like; involved in
rRNA processing; involved in ribosome biogenesis and assembly
|
| Entry clone |
Cloned |
| ORF length (unspliced) |
1002 |
| ORF length (spliced) |
|
| Entry clone length |
1002 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
775T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC17H9.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAGGAATAGAATCAAA |
| Rev primer name |
SPAC17H9.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTCTAGCCTTTTCACGT |
| Amino acid length |
333 |
| Molecular weight |
37.8 |
| Isoelectric point (calc.) |
10.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleolus>>nucleus; SPB? |
| Comments for localization |
dots at nucleolus by
over expression; SPB by over expression? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |