Gene name |
SPCC1393.09c |
Gene ID |
15/B01 |
Gene synonyms/obsolete |
|
Gene product |
conserved
hypothetical; conserved protein |
Entry clone |
Cloned |
ORF length (unspliced) |
1016 |
ORF length (spliced) |
648 |
Entry clone length |
1016 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
691A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1393.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTTCTGCAATCGAAGA |
Rev primer name |
SPCC1393.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCCTCTCCCTCAACATCG |
Amino acid length |
215 |
Molecular weight |
24.6 |
Isoelectric point (calc.) |
4.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |