Gene name |
SPBC9B6.01c |
Gene ID |
15/E07 |
Gene synonyms/obsolete |
SPBC18H10.21c;
SPAC9B6.01c |
Gene product |
very hypothetical
protein |
Entry clone |
Cloned# |
ORF length (unspliced) |
1029 |
ORF length (spliced) |
474 |
Entry clone length |
1029 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC9B6.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATGGACTAAGAGTGTT |
Rev primer name |
SPBC9B6.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAATTAAAGTCCATTTTTGT |
Amino acid length |
157 |
Molecular weight |
18.3 |
Isoelectric point (calc.) |
10 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
2 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
DeltaVision |