Gene name |
SPBC30B4.01c |
Gene ID |
15/F09 |
Gene synonyms/obsolete |
SPBC3D6.14c |
Gene product |
conserved
hypothetical; hypothetical serine-rich protein; WSC domain;
involved in carbohydrate binding; proteophosphoglycan |
Entry clone |
Cloned |
ORF length (unspliced) |
1035 |
ORF length (spliced) |
|
Entry clone length |
1035 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
264T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC30B4.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACACTCAATATGGCTG |
Rev primer name |
SPBC30B4.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTTCAAATTTGTGACACGC |
Amino acid length |
344 |
Molecular weight |
34.9 |
Isoelectric point (calc.) |
6.4 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
periphery |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |