| Gene name |
SPCC1223.02 |
| Gene ID |
15/G09 |
| Gene synonyms/obsolete |
nmt1; thi3 |
| Gene product |
experimentally
characterised; involved in the regulation of thiamine
biosynthesis; repressed by thiamine; involved in
hydroxymethylpyrimidine synthesis; involved in thiamine
synthesis; deletion mutant results in thiamine auxotrophy; no
message in thiamine; co-ordinately regulated with nmt1???
|
| Entry clone |
Cloned |
| ORF length (unspliced) |
1041 |
| ORF length (spliced) |
|
| Entry clone length |
1041 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
686A:G / 986A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1223.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTACTAACAAGATCAC |
| Rev primer name |
SPCC1223.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGGTTGGCAGGCTCGACA |
| Amino acid length |
346 |
| Molecular weight |
38.9 |
| Isoelectric point (calc.) |
6.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |