Gene name |
SPBP35G2.08c |
Gene ID |
15/H06 |
Gene synonyms/obsolete |
|
Gene product |
zinc finger protein;
zf-CCHC type (zinc knuckle) |
Entry clone |
Cloned |
ORF length (unspliced) |
1046 |
ORF length (spliced) |
942 |
Entry clone length |
1046 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
434T:C / 511T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBP35G2.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTGTTTCAAACCAAAA |
Rev primer name |
SPBP35G2.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCATTTTCGTTTACGATTT |
Amino acid length |
313 |
Molecular weight |
35.2 |
Isoelectric point (calc.) |
7.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLQKINSLPI |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Leica |