Gene name |
SPAC22E12.18 |
Gene ID |
16/A06 |
Gene synonyms/obsolete |
|
Gene product |
conserved hypothetical
protein |
Entry clone |
Cloned |
ORF length (unspliced) |
1050 |
ORF length (spliced) |
1011 |
Entry clone length |
1050 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC22E12.18.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGACACTATGGTAAA |
Rev primer name |
SPAC22E12.18.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTTTGAGATACTATTTCC |
Amino acid length |
336 |
Molecular weight |
38.4 |
Isoelectric point (calc.) |
4.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
250 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
Microscope used for
observation |
DeltaVision |