| Gene name |
SPAC19D5.06c |
| Gene ID |
16/C03 |
| Gene synonyms/obsolete |
din1 |
| Gene product |
nuclear exonuclease
binding protein; possibly enhances the function of nuclear
exonuclease; Dhp1p (5'-to-3' exoribonuclease required for
proper chromosome segregation) -interacting protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1059 |
| ORF length (spliced) |
|
| Entry clone length |
1059 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
735G:A / 817A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC19D5.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTTCGTGAATTTTCGTT |
| Rev primer name |
SPAC19D5.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATTATTTGTCGTAAAACA |
| Amino acid length |
352 |
| Molecular weight |
40.7 |
| Isoelectric point (calc.) |
5.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |