Gene name |
SPAC30D11.07 |
Gene ID |
16/D03 |
Gene synonyms/obsolete |
nth1 |
Gene product |
DNA N-glycosylase
activity; DNA-(apurinic or apyrimidinic site) lyase activity;
involved in DNA repair; involved in nucleotide-excision
repair; involved in base-excision repair; deletion mutant
sensitive to MMS |
Entry clone |
Cloned |
ORF length (unspliced) |
1068 |
ORF length (spliced) |
|
Entry clone length |
1068 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
272A:G / 451G:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC30D11.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTAAAGACTACGGAAC |
Rev primer name |
SPAC30D11.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAACCAGATCTTCAATATCT |
Amino acid length |
355 |
Molecular weight |
40.2 |
Isoelectric point (calc.) |
8.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKEKLAGGLCL |
Localization (YFP) |
nucleus; nuclear dots
|
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |