Gene name |
SPAC1B3.03c |
Gene ID |
16/E05 |
Gene synonyms/obsolete |
wis2; cyp5 |
Gene product |
cyclophilin; involved
in the regulation of mitosis; TPR repeat protein (inferred
from context); heat shock inducible 40 kDa protein;
peptidyl-prolyl cis-trans isomerase |
Entry clone |
Cloned |
ORF length (unspliced) |
1071 |
ORF length (spliced) |
|
Entry clone length |
1071 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
154A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC1B3.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTACTTACGCCTATTT |
Rev primer name |
SPAC1B3.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTGAAACATCTTAGCATAG |
Amino acid length |
356 |
Molecular weight |
40.1 |
Isoelectric point (calc.) |
8.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRYSIYANLAL |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |