| Gene name |
SPAC16A10.04 |
| Gene ID |
16/F09 |
| Gene synonyms/obsolete |
rho4 |
| Gene product |
Rho family; small
GTPase; similar to Sp SPAC20H4.11c (paralog); non-essential;
involved in cellular morphogenesis; involved in cytokinesis;
involved in septation; involved in regulation of the actin
cytoskeleton; involved in cell wall organization and
biogenesis (IGI) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1078 |
| ORF length (spliced) |
618 |
| Entry clone length |
1078 |
| No. of intron |
5 |
| Sequence status |
Finished |
| Sequence results |
904C:T / 1067G:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC16A10.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAATGTTTAGCTTGGA |
| Rev primer name |
SPAC16A10.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAAAATCACGCAAGACTTT |
| Amino acid length |
205 |
| Molecular weight |
22.6 |
| Isoelectric point (calc.) |
5.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
almost no apparent
signal |
| Comments for localization |
cytosol and nucleus?
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |