Gene name |
SPAC18G6.07c |
Gene ID |
16/G05 |
Gene synonyms/obsolete |
mra1 |
Gene product |
downstream factor of
Ras; involved in cell growth (required); involved in
conjugation (required); involved in ribosome biogenesis and
assembly |
Entry clone |
Cloned in 2004
trial |
ORF length (unspliced) |
1080 |
ORF length (spliced) |
|
Entry clone length |
1080 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC18G6.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTACTTATTCCAAAAG |
Rev primer name |
SPAC18G6.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATACAATTCCTAGAAAGTCT |
Amino acid length |
359 |
Molecular weight |
39.7 |
Isoelectric point (calc.) |
8.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LMVQLLHKLSI/LHSMEDFLGI |
Localization (YFP) |
nucleus>>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>>cytosol) |
Microscope used for
observation |
DeltaVision |