| Gene name |
SPAC6B12.01 |
| Gene ID |
16/H05 |
| Gene synonyms/obsolete |
SPAC1B9.03c |
| Gene product |
RNA-binding protein;
eukaryotic conserved protein; involved in RNA processing;
involved in ribosome biogenesis and assembly; Brix
domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1288 |
| ORF length (spliced) |
1170 |
| Entry clone length |
1288 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
ORF prediction was
changed; Joined to SPAC1B9.03c. |
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC6B12.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAGGCATTGGTAAAAA |
| Rev primer name |
SPAC6B12.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCTGTATCAGAATAAGCA |
| Amino acid length |
389 |
| Molecular weight |
44.2 |
| Isoelectric point (calc.) |
10.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
356/340/341/9 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleolus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss |