| Gene name |
SPBC17F3.01c |
| Gene ID |
16/H09 |
| Gene synonyms/obsolete |
rga5; SPBC557.01 |
| Gene product |
GTPase activator;
RhoGAP domain; overexpression lethal; non-essential; deletion
mutant results in multiseptation at high temperatures;
involved in cell morphogenesis (regulation); involved in cell
wall biosynthesis (regulation); double mutant
rga5delta/rga1delta unable to germinate (possibly); double
mutant rga5delta/rga2,3, 4,and 6delta no apparent genetic
interaction (Nakano et. al); specific Rho1p GAP; negatively
regulates (1,3)beta-D-glucan synthase; regulates the
interaction of Rho1p with Pck1p and Pck2p C7 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1086 |
| ORF length (spliced) |
|
| Entry clone length |
1086 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
626T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC17F3.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTGTTGTCGTAGGAGT |
| Rev primer name |
SPBC17F3.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACATACGATTTTCCCTCCGG |
| Amino acid length |
361 |
| Molecular weight |
40.9 |
| Isoelectric point (calc.) |
10.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
periphery |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |