| Gene name |
SPAC3G9.09c |
| Gene ID |
17/A04 |
| Gene synonyms/obsolete |
tif211 |
| Gene product |
translation initiation
factor (2 alpha subunit) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1089 |
| ORF length (spliced) |
921 |
| Entry clone length |
1089 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
134T:C /
333T:addition |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3G9.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGACGACAAGCTGCAG |
| Rev primer name |
SPAC3G9.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCAGAACCGCTTTGGTCA |
| Amino acid length |
306 |
| Molecular weight |
34.5 |
| Isoelectric point (calc.) |
6.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTNALDKSLGL |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|