| Gene name |
SPBC3B8.07c |
| Gene ID |
17/A06 |
| Gene synonyms/obsolete |
dsd1 |
| Gene product |
dihydrosphingosine
delta 4 desaturase (pers. comm. Jonathan Napier); sphingolipid
delta-4-desaturase (dihydroceramide desaturase) (pers. comm.
Jonathan Napier); possible early signal for meiotic
differentiation; fatty acid desaturase; no apparent Sc
ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1089 |
| ORF length (spliced) |
|
| Entry clone length |
1089 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC3B8.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCCGAATCAACTGCTAC |
| Rev primer name |
SPBC3B8.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGAAACATGAAGGTGCATT |
| Amino acid length |
362 |
| Molecular weight |
41.8 |
| Isoelectric point (calc.) |
7.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
5 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|