| Gene name |
SPAC3F10.10c |
| Gene ID |
17/B12 |
| Gene synonyms/obsolete |
map3 |
| Gene product |
pheromone M-factor
receptor; involved in meiosis (initiation); G-protein coupled
receptor |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1098 |
| ORF length (spliced) |
|
| Entry clone length |
1098 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
528C:T / 774G:C /
861T:C / 975A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3F10.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTGCCTATTGGGATTTT |
| Rev primer name |
SPAC3F10.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGACATATTTGGCGGCGTCT |
| Amino acid length |
365 |
| Molecular weight |
42.4 |
| Isoelectric point (calc.) |
8.5 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
6 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLLLFWLTL/LSILLPLII |
| Localization (YFP) |
nuclear envelope?;
nuclear dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal;
DeltaVision |