Gene name |
SPCC1281.08 |
Gene ID |
17/C01 |
Gene synonyms/obsolete |
wtf11 |
Gene product |
wtf element |
Entry clone |
Cloned in 2004
trial |
ORF length (unspliced) |
1098 |
ORF length (spliced) |
795 |
Entry clone length |
1098 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC1281.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACAGCAATTACGTTCC |
Rev primer name |
SPCC1281.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACAATTCATCTGAATCTTCA |
Amino acid length |
264 |
Molecular weight |
29.9 |
Isoelectric point (calc.) |
4.9 |
Signal SEQ |
|
No. of transmembrane domain |
4 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
a few cytoplasmic
dots; Golgi? |
Comments for localization |
Golgi?; moving small
cytoplasmic dots by over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |