| Gene name |
SPAC1006.05c |
| Gene ID |
17/C05 |
| Gene synonyms/obsolete |
och1 |
| Gene product |
alpha-1,6-mannosyltransferase; Transfers an
alpha-D-mannosyl residue from GDP-mannose into lipid-linked
oligosaccharide, forming an alpha- 1,6-D-mannosyl-D-mannose
linkage; involved in the initiation of outer chain elongation
of asparagine-linked oligosaccharides of the type
Man(9)GlcNAc(2) present in the cell wall; expression induced
by salt stress |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1191 |
| ORF length (spliced) |
|
| Entry clone length |
1191 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
ORF prediction was
changed. |
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC1006.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTGAGACTCCGATTGAG |
| Rev primer name |
SPAC1006.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCATCTTTCCATGAACCG |
| Amino acid length |
396 |
| Molecular weight |
45.9 |
| Isoelectric point (calc.) |
4.3 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKADFFRYLVL/LVGDVLILPI |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|